Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

Over-expression of lysophosphatidic acid receptor-2 in human invasive ductal carcinoma

Breast Cancer Research volume 6, Article number: R640 (2004) Cite this article

Abstract

Introduction

Lysophosphatidic acid (LPA) is a bioactive phospholipid with diverse effects on various cells. It interacts with at least three G-protein-coupled transmembrane receptors, namely LPA1, LPA2 and LPA3, whose expression in various tumours has not been fully characterized. In the present study we characterized the expression profile of LPA receptors in human breast cancer tissue and assessed the possible roles of each receptor.

Methods

The relative expression levels of each receptor's mRNA against β-actin mRNA was examined in surgically resected invasive ductal carcinomas and normal gland tissue using real-time RT-PCR. LPA2 expression was also examined immunohistochemically using a rat anti-LPA2 monoclonal antibody.

Results

In 25 cases normal and cancer tissue contained LPA1 mRNA at similar levels, whereas the expression level of LPA2 mRNA was significantly increased in cancer tissue as compared with its normal counterpart (3479.0 ± 426.6 versus 1287.3 ± 466.8; P < 0.05). LPA3 was weakly expressed in both cancer and normal gland tissue. In 48 (57%) out of 84 cases, enhanced expression of LPA2 protein was confirmed in carcinoma cells as compared with normal mammary epithelium by immunohistochemistry. Over-expression of LPA2 was detected in 17 (45%) out of 38 premenopausal women, as compared with 31 (67%) out of 46 postmenopausal women, and the difference was statistically significant (P < 0.05).

Conclusion

These findings suggest that upregulation of LPA2 may play a role in carcinogenesis, particularly in postmenopausal breast cancer.

Introduction

Lysophosphatidic acid (LPA; 1- or 2-acyl-sn-glycero-3-phosphate), the simplest glycerophospholipid, mediates a broad range of cellular responses including smooth muscle cell contraction, platelet aggregation, neurite retraction/cell rounding, regulation of cell proliferation, protection from apoptosis, modulation of chemotaxis and transcellular migration [1–3]. Previous reports have also demonstrated that LPA stimulates proliferation, migration and production of matrix metalloproteinases and angiogenic factors in ovarian cancer cell lines [4–9]. Moreover, a high level of LPA has been detected in ascitic fluid from ovarian cancer patients [4, 10, 11]. These findings suggest that LPA may be a mediator of tumour development and progression [12].

At least three receptors – LPA1/Edg-2, LPA2/Edg-4 and LPA3/Edg-7 – have been identified as specific receptors for LPA [13, 14]. These LPA receptors differ with respect to their distribution in various tissues. LPA1 is broadly expressed in various normal tissues, whereas expression levels of LPA2 and LPA3 are more restricted, which may account for the various biological effects of LPA [13, 14]. In recent studies LPA1 and LPA2 were found to have redundant functions in mediating multiple endogenous LPA responses, including phospholipase C activation, calcium mobilization, cell proliferation and stress fibre formation in mouse embryonic fibroblast cells [15, 16]. However, in the same study the different phenotypes of knockout mice for each receptor suggested distinct roles for LPA1 and LPA2 in vivo.

Previous studies also found that malignant transformation resulted in aberrant expression of LPA2 or LPA3 in ovarian or thyroid cancers, suggesting that LPA may play a role in tumour biology and that shifts in LPA receptor expression are related to carcinogenesis [17–20]. However, patterns of expression of these LPA receptors in other tumours have not been adequately examined. In the present study we characterized the expression patterns of LPA receptors in human breast cancer tissue (another common form of cancer in females) and analyzed correlations with other clinical and pathological findings to determine the possible role played by each LPA receptor in the development of breast cancer.

Methods

Patients and materials

In the first part of the study, mRNA expression for each LPA receptor was evaluated in 25 cases of invasive ductal carcinoma, which were surgically resected in the Department of Surgery, University of Tokyo, from 1998 to 2003, and in six samples of adjacent normal gland tissue. In the next part of the study, protein expression of LPA2 was evaluated by immunohistochemical staining in the 25 cases and an additional 59 cases of invasive ductal carcinoma, which were resected from 1992 to 1997, also in the Department of Surgery, University of Tokyo.

All of the resected primary tumours and regional lymph nodes were histologically examined by haematoxylin–eosin staining, in accordance with the International Union Against Cancer TNM classification. Several discrete histological parameters and lymph node metastasis were also examined. Oestrogen receptor levels were evaluated using enzyme immunoassay of frozen tumour specimens with cutoff levels for positivity of 5 fmol/mg protein.

Isolation of total RNA and reverse transcription

The tumour tissue resected from the primary lesion and paired nontumour tissue (taken 10 cm away from the neoplasm) were immediately frozen in liquid nitrogen and kept at -80°C until extraction of RNA. Total RNA was extracted from each sample using the acid guanidine isothiocyanate/phenol/chloroform extraction method. One microgram of total RNA was reverse transcribed using a SuperScript First-Strand Synthesis System (Invitrogen Co., Carlsbad, CA, USA). The reverse transcription reaction was carried out in a total volume of 20 μl, in accordance with the manufacturer's instructions. The cDNA was stored at -20°C until use.

Preparation of cDNA calibrators

We used pcDNA3 vector (Invitrogen) containing LPA1, LPA2, or LPA3 as the standard cDNA for each LPA receptor [14]. cDNA for human β-actin was prepared using human colon cDNA as the template DNA and the following oligonucleotides: CCATCGAATTCACCACCATGGATGATGATATCGCCGCGCTC and AAGGTGCGGCCGCCTAGAAGCATTTGCGGTGGACGAT. The resulting DNA fragments were digested by EcoRI/NotI and ligated into pBlueScript (Strategene, La Jolla, CA, USA). The DNA sequence of cDNA prepared by RT-PCR was confirmed by DNA sequencing and used to calibrate for β-actin.

Real-time fluorescence quantitative PCR

The primers used in the analysis of LPA1, LPA2, LPA3 and β-actin gene expression are given in Table 1. All the primers were designed using Primer Express software (Applied Biosystems, Foster, CA, USA). Real-time PCR reactions were conducted in an ABI PRISM 7000 (Perkin-Elmer/Applied Biosystems, Foster, CA, USA) using SYBR Green I (Perkin-Elmer) with the following profile: one step at 50°C for 2 min, one step at 95°C for 10 min, and 40 cycles at 95°C for 30 s and 60°C for 1 min. Thermocycling was done in a final volume of 20 μl containing 1 μl of cDNA sample. The ABI PRISM software constructed the calibration curve by plotting the crossing point against the logarithm of the number of copies for each calibrator. The number of copies in unknown samples was calculated by comparing their crossing points with the calibration curve. To correct for differences in both RNA quality and quantity between samples, data were normalized using the ratio of the target cDNA concentration to that of β-actin. Both RT and PCR reactions were performed in triplicate, and the mean values were calculated against against β-actin.

Table 1 Lysophosphatidic acid receptor 2 (LPA2) expression evaluated by RT-PCR and immunohistochemistry
Full size table

Monoclonal antibodies against human LPA2

A peptide consisting of the carboxyl-terminal 17 amino acids of human LPA2 (335–351) was conjugated with keyhole limpet haemocyanin. The conjugate was injected into the hind foot pads of WKY/Izm rats using Freund's complete adjuvant. The enlarged medial iliac lymph nodes from the rats were used for cell fusion with mouse myeloma cell line PAI. The antibody-secreting hybridoma cells were selected by screening with enzyme-linked immunosorbent assay, immunofluorescence and Western blotting. Several clones were established. In this study, monoclonal antibody from clone 10D5 (rat IgG1) was used for immunohistochemical staining.

Specificity of the monoclonal antibody against human LPA2 used in the present study (clone 10D5) was confirmed as follows. HeLa cells were transfected with LPA1-pcDNA3, LPA2-pcDNA3, LPA3-pcDNA3, or empty pcDNA3 vector using lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection, the cells were rinsed with phosphate-buffered saline (PBS) and recovered using a cell scraper. Protein (10 μg) was separated on SDS-PAGE (12.5% polyacrylamide) and transferred onto nitrocellulose transfer membrane (Schleicher & Schuell, Einbeck, Germany). Using the enhanced chemiluminescence (ECL) method, the expression of each receptor was confirmed using anti-LPA1, anti-LPA2, or anti-LPA3 antibodies (Fig. 1).

Figure 1
figure 1

Specificity of anti-human lysophosphatidic acid receptor 2 (LPA2) antibody. The cross-reactivity of anti-human LPA2 (clone 10D5) was examined by Western blotting. Cell lysate of HeLa cells transfected with human lysophosphatidic acid receptor 1 (LPA1; lane1), LPA2 (lane 2), LPA3 (lane 3), or empty vector (lane4) were loaded onto SDS-PAGE. After the proteins were transferred onto nitrocellulose membrane, the LPA2 protein was detected using antihuman LPA2 antibody (clone 10D5) in an enhanced chemiluminescence (ECL) system. 10D5 did not exhibit cross-reactivity to LPA1 or LPA3.

Full size image

Immunohistochemical study of LPA2

Expression of LPA2 was examined by immunohistochemical staining using the anti-LPA2 antibody. Sections (3 μm thick) were deparaffinized in xylene, hydrated through a gradually diluted ethanol series, and heated in a microwave oven for two 7-min cycles (500 W). After being rinsed in PBS, endogenous peroxidase activity was inhibited by incubation with 0.3% hydrogen peroxide in 100% methanol for 30 min. After washing three times in PBS, nonspecific reaction was blocked by incubation with PBS containing 5% skimmed milk for 30 min at room temperature, and then the sections were incubated with normal rabbit serum for 30 min. The sections were incubated overnight at 4°C in humid chambers with the primary antibody to LPA2 at a dilution of 1/100. As negative control, anti-LPA1 monoclonal antibody (rat IgG1), as well as control rat IgG (Nichirei, Tokyo, Japan), was used. After washing three times with PBS, the sections were incubated with biotinylated rabbit antirat immunoglobulin for 30 min. After washing again with PBS, the slides were treated with peroxidase-conjugated streptavidin for 30 min, and developed by immersion in 0.01% hydrogen peroxide and 0.05% diaminobenzidine tetrahydrochloride for 3 min, followed by light counterstaining with Mayer's haematoxylin. Immunoreactivity was assessed by two evaluators who had no knowledge of the background features. When more than half of the carcinoma cells in these fields exhibited significantly stronger staining intensity than the corresponding epithelium from normal mammary glands, these tumours were defined as having high expression of LPA2. In other tumours, most of the carcinoma cells exhibited only weak, if any, immunostaining, and, if present, the staining intensity was similar to that of normal epithelium; these tumours were thus defined as having low expression of LPA2.

Statistical analysis

All statistical calculations were conducted using StatView-J 5.0 statistical software (SAS Institute, Cary, NC, USA). mRNA levels were compared using unpaired Student's t-test, and relationships between the over-expression of LPA2 and clinicopathological features were examined by Fisher's exact test. P < 0.05 was considered statistically significant.

Results

Expression of LPA receptors at the mRNA level

The relative expression level of each LPA receptor's mRNA was quantitatively evaluated by real-time RT-PCR against that of β-actin (Fig. 2). A significant level of LPA1 mRNA was detected in both normal and carcinoma tissues, and expression levels did not differ significantly between tissues (1438.5 ± 425.5 versus 1675.3 ± 299.8). However, the expression level of LPA2 in cancer tissue was significantly greater than that in normal tissue (3479.0 ± 426.6 versus 1287.3 ± 466.8; P < 0.05). In comparison, LPA3 was weakly expressed in both normal and cancer tissue, although one cancer contained a relatively high level of LPA3 transcript. When the ratio of LPA2 to LPA1 was calculated, cancer tissue exhibited a threefold higher ratio than did normal gland tissue (3.69 ± 0.96 versus 1.12 ± 0.43; P = 0.0016).

Figure 2
figure 2

Relative expression level of lysophosphatidic acid receptors' mRNA against β-actin in cancer tissue and normal mammary gland tissue, evaluated using real-time RT-PCR: (a) Lysophosphatidic acid receptor 1 (LPA1), (b) LPA2 and (c) LPA3. Y axis indicates the cDNA copies for lysophosphatidic acid receptors divided by that of β-actin in each case. *P < 0.05.

Full size image

Expression of LPA2 receptor in the immunohistochemical study

The expression of LPA2 in the same tumours was also evaluated at the protein level by immunohistochemical staining (Fig. 3). In 15 out of 25 (60%) carcinomas, enhanced staining for LPA2 was clearly detected in comparison with normal tissue. In these carcinoma cells, LPA2 was detectable in the cytoplasm and in the cell membrane, but not in the nucleus. Some of the normal epithelium in the same specimens, as well as interstitial cells, also stained slightly, but the intensity was significantly weaker than that in carcinoma cells in the 15 tumours. Thus, these cases were categorized as tumours with high LPA2 expression. In the other 10 tumours, carcinoma cells exhibited apparently the same staining intensity as normal epithelium and were categorized as having low expression of LPA2.

Figure 3
figure 3

Staining patterns of lysophosphatidic acid receptor 2 (LPA2) in normal mammary epithelium (upper left) and carcinoma tissues (upper right) of a representative case with high expression, and in another tumour tissue sample with low expression of LPA2 (lower left). Some of the normal epithelial cells in the same specimens, as well as interstitial cells, are slightly stained, but the intensity is significantly weaker than that in carcinoma cells with high expression of LPA2. LPA2 can be detected in the cytoplasm as well as in the cell membrane, but not in the nucleus (lower right).

Full size image

When the immunoreactivity was compared with the relative ratio of LPA2 mRNA against β-actin, 11 out of the 12 tumours (92%) with ratios greater than 3000 had high expression of LPA2, whereas 10 out of 13 tumours with a ratio below 3000 had low expression (Table 1). Thus, the results of the immunohistochemical study exhibited significant correlation with the results of quantitative mRNA study in breast cancer tissue (P < 0.001).

Relationship between LPA2 expression and clinical and pathological factors

Because LPA2 expression showed a strong correlation between mRNA and protein levels in 25 cases, we performed immunostaining of LPA2 in an additional 59 cases. The relations between LPA2 expression and clinical or pathological findings in these 84 cases are presented in Table 2. High expression of LPA2 was frequently detected in relatively old postmenopausal patients. High expression of LPA2 was detected in 17 out of 38 (45%) premenopausal patients and in 31 out of 46 (67%) postmenopausal women; this difference was statistically significant (P < 0.05). LPA2 expression did not correlate with oestrogen receptor expression. The frequency of nodal or distant metastasis tended to be higher in tumours with low expression of LPA2, although the difference was not statistically significant.

Table 2 The relationship between lysophosphatidic acid receptor 2 (LPA2) expression and clinical/pathological factor
Full size table

Discussion

In the present study we found that breast cancer frequently exhibited enhanced expression of LPA2 mRNA as compared with normal breast gland tissue, although the expression level of LPA1 and that of LPA3 were not significantly different from those in normal tissue. Over-expression of LPA2 was confirmed at the protein level in some of these cases by immunohistochemical staining. Previous studies showed that LPA1 is widely expressed in various tissues, whereas LPA2 and LPA3 are known to be highly expressed in malignant cells, suggesting the potential role of these receptors in the pathophysiology of cancer [5, 18, 19, 21, 22]. Our findings regarding LPA2 are basically consistent with those results and suggest that upregulation of the LPA2 gene is a common feature of carcinogenesis in various organs.

Protein expression of LPA2 in various organs has not been investigated thus far because of the lack of an appropriate antibody against LPA2. Our antibody clearly detected significantly enhanced expression of LPA2 in more than half of the ductal carcinoma cells, and the staining pattern exhibited a strong correlation with the mRNA data obtained with quantitative RT-PCR. Normal epithelium of mammary glands also showed slight immunoreactivity, but the staining intensity was markedly weaker than that of carcinoma cells in these cases. Positive staining was mostly detected in the cytosol and cellular membrane of carcinoma cells, although the distribution of immunoreactivity differed among the cells in each case, indicating that the cellular distribution of LPA2 is highly heterogeneous, even within the same tumour.

The exact role played over-expression of LPA2 in breast carcinogenesis is not yet clear. However, in ovarian cancer cells the proliferative responses to LPA of ovarian cancer cells with high levels of LPA1 receptor were uniformly weaker than those of cells with low LPA1 receptor levels [22]. Moreover, LPA1 has been reported to transduce the inhibitory signal to LPA2-mediated proliferative responses and concurrently elicits apoptosis and anoikis [23]. On the other hand, LPA has been shown to have an antiapoptotic effect on various cells, although the LPA receptor that mediates this response has not been determined [24, 25]. Deng and coworkers [26] reported that LPA prevents apoptosis of rat intestinal epithelial cells (IEC-6) induced by radiation and chemotherapeutic agents. In that study they used receptor specific inhibitors and concluded that the antiapoptotic effect was mediated through both LPA1 and LPA2. Thus, LPA1 can mediate both antiapoptotic and apoptotic effects, and this is apparently dependent on the cell type and circumstances. Taken together, these findings indicate that the stimulation of LPA1 receptor has suppressive effects, at least in part, on cell proliferation as compared with the LPA2 receptor. Thus, the enhanced expression of LPA2 with relatively reduced expression of LPA1 appears to promote mammary epithelial cell survival in LPA-rich circumstances and to favour development of breast cancer.

Immunohistochemical finding showed that LPA2 is upregulated more frequently in postmenopausal than in premenopausal women, suggesting that over-expression of LPA2 is more strongly related to the carcinogenesis of postmenopausal breast cancer. It is well known that a high-fat diet has a positive association with development of breast cancer, especially postmenopausal breast cancer, although some conflicting findings have also been reported [27–32]. A high-fat diet is often associated with the insulin resistance syndrome, and hyperinsulinaemia and high level of insulin-like growth factor (IGF) have also been reported to be markers of increased breast cancer risk [33–36]. Recently, receptors for IGF-1 were shown to be functionally expressed in mammary epithelium [37–39]. Moreover, the IGF-mediated intracellular signal closely interacts with the LPA-mediated signal, although the specific mechanism is not yet known [40–43]. Therefore, our data raise the possibility that a shift in LPA receptor expression may alter the effects of the LPA on IGF-mediated signal in mammary epithelial cells, which may be closely associated with adiposity-related carcinogenesis of breast cancer. The crosstalk between the LPA1- or LPA2-mediated signal and the IGF- or insulin-mediated signal remains an interesting subject for future study.

In summary, we found preferential expression of LPA2 in ductal carcinoma as compared with normal epithelium in human mammary gland tissue. Over-expression of LPA2 was more prominent in postmenopausal women. A shift in LPA receptor expression in mammary epethelium may be a key event, especially in adiposity-related breast carcinogenesis. LPA and its receptors could represent new chemopreventive targets in a novel therapeutic strategy in human breast cancer.

Conclusion

Human ductal carcinoma cells frequently exhibited enhanced expression of LPA2 as compared with normal epithelium in human mammary gland tissue, especially in postmenopausal women. This suggests that upregulation of LPA2 may be one of the key events in carcinogenesis, especially in adiposity-related breast cancer.

Abbreviations

IGF:

insulin-like growth factor

LPA:

lysophosphatidic acid

PBS:

phosphate-buffered saline

PCR:

polymerase chain reaction

RT:

reverse transcription.

References

  1. Moolenaar WH: Lysophosphatidic acid, a multifunctional phospholipid messenger. J Biol Chem. 1995, 270: 12949-12952.

    Article  CAS  PubMed  Google Scholar 

  2. Moolenaar WH: Bioactive lysophospholipids and their G protein-coupled receptors. Exp Cell Res. 1999, 253: 230-238. 10.1006/excr.1999.4702.

    Article  CAS  PubMed  Google Scholar 

  3. Goetzl EJ, An S: Diversity of cellular receptors and functions for the lysophospholipid growth factors lysophosphatidic acid and sphingosine 1-phosphate. FASEB J. 1998, 12: 1589-1598.

    CAS  PubMed  Google Scholar 

  4. Erickson JR, Hasegawa Y, Fang X, Eder A, Mao M, Furui T, Aoki J, Morris A, Mills GB: Lysophosphatidic acid and ovarian cancer: a paradigm for tumorogenesis and patient management. Prostaglandins. 2001, 64: 63-81. 10.1016/S0090-6980(01)00100-9.

    Article  CAS  Google Scholar 

  5. Goetzl EJ, Dolezalova H, Kong Y, Hu YL, Jaffe RB, Kalli KR, Conover CA: Distinctive expression and functions of the type 4 endothelial differentiation gene-encoded G protein-coupled receptor for lysophosphatidic acid in ovarian cancer. Cancer Res. 1999, 59: 5370-5375.

    CAS  PubMed  Google Scholar 

  6. Hu YL, Tee MK, Goetzl EJ, Auersperg N, Mills GB, Ferrara N, Jaffe RB: Lysophosphatidic acid induction of vascular endothelial growth factor expression in human ovarian cancer cells. J Natl Cancer Inst. 2001, 93: 762-768. 10.1093/jnci/93.10.762.

    Article  CAS  PubMed  Google Scholar 

  7. Fishman DA, Liu Y, Ellerbroek SM, Stack MS: Lysophosphatidic acid promotes matrix metalloproteinase (MMP) activation and MMP-dependent invasion in ovarian cancer cells. Cancer Res. 2001, 61: 3194-3199.

    CAS  PubMed  Google Scholar 

  8. Schwartz BM, Hong G, Morrison BH, Wu W, Baudhuin LM, Xiao YJ, Mok SC, Xu Y: Lysophospholipids increase interleukin-8 expression in ovarian cancer cells. Gynecol Oncol. 2001, 81: 291-300. 10.1006/gyno.2001.6124.

    Article  CAS  PubMed  Google Scholar 

  9. Mills GB, Eder A, Fang X, Hasegawa Y, Mao M, Lu Y, Tanyi J, Tabassam FH, Wiener J, Lapushin R, et al: Critical role of lysophospholipids in the pathophysiology, diagnosis, and management of ovarian cancer. Cancer Treat Res. 2002, 107: 259-283.

    CAS  PubMed  Google Scholar 

  10. Xu Y, Shen Z, Wiper DW, Wu M, Morton RE, Elson P, Kennedy AW, Belinson J, Markman M, Casey G: Lysophosphatidic acid as a potential biomarker for ovarian and other gynecologic cancers. JAMA. 1998, 280: 719-723. 10.1001/jama.280.8.719.

    Article  CAS  PubMed  Google Scholar 

  11. Baker DL, Morrison P, Miller B, Riely CA, Tolley B, Westermann AM, Bonfrer JM, Bais E, Moolenaar WH, Tigyi G: Plasma lysophosphatidic acid concentration and ovarian cancer. JAMA. 2002, 287: 3081-3082. 10.1001/jama.287.23.3081.

    Article  PubMed  Google Scholar 

  12. Mills GB, Moolenaar WH: The emerging role of lysophosphatidic acid in cancer. Nat Rev Cancer. 2003, 3: 582-591. 10.1038/nrc1143.

    Article  CAS  PubMed  Google Scholar 

  13. An S, Bleu T, Hallmark OG, Goetzl EJ: Characterization of a novel subtype of human G protein-coupled receptor for lysophosphatidic acid. J Biol Chem. 1998, 273: 7906-7910. 10.1074/jbc.273.14.7906.

    Article  CAS  PubMed  Google Scholar 

  14. Bandoh K, Aoki J, Hosono H, Kobayashi S, Kobayashi T, Murakami-Murofushi K, Tsujimoto M, Arai H, Inoue K: Molecular cloning and characterization of a novel human G-protein-coupled receptor, EDG7, for lysophosphatidic acid. J Biol Chem. 1999, 274: 27776-27785. 10.1074/jbc.274.39.27776.

    Article  CAS  PubMed  Google Scholar 

  15. Contos JJ, Fukushima N, Weiner JA, Kaushal D, Chun J: Requirement for the lpA1 lysophosphatidic acid receptor gene in normal suckling behavior. Proc Natl Acad Sci USA. 2000, 97: 13384-13389. 10.1073/pnas.97.24.13384.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Contos JJ, Ishii I, Fukushima N, Kingsbury MA, Ye X, Kawamura S, Brown JH, Chun J: Characterization of lpa(2) (Edg4) and lpa(1)/lpa(2) (Edg2/Edg4) lysophosphatidic acid receptor knockout mice: signaling deficits without obvious phenotypic abnormality attributable to lpa(2). Mol Cell Biol. 2002, 22: 6921-6929. 10.1128/MCB.22.19.6921-6929.2002.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Fang X, Gaudette D, Furui T, Mao M, Estrella V, Eder A, Pustilnik T, Sasagawa T, Lapushin R, Yu S, et al: Lysophospholipid growth factors in the initiation, progression, metastases, and management of ovarian cancer. Ann N Y Acad Sci. 2000, 905: 188-208.

    Article  CAS  PubMed  Google Scholar 

  18. Schulte KM, Beyer A, Kohrer K, Oberhauser S, Roher HD: Lysophosphatidic acid, a novel lipid growth factor for human thyroid cells: over-expression of the high-affinity receptor edg4 in differentiated thyroid cancer. Int J Cancer. 2001, 92: 249-256. 10.1002/1097-0215(200102)9999:9999<::AID-IJC1166>3.0.CO;2-D.

    Article  CAS  PubMed  Google Scholar 

  19. Fang X, Schummer M, Mao M, Yu S, Tabassam FH, Swaby R, Hasegawa Y, Tanyi JL, LaPushin R, Eder A, et al: Lysophosphatidic acid is a bioactive mediator in ovarian cancer. Biochim Biophys Acta. 2002, 1582: 257-264. 10.1016/S1388-1981(02)00179-8.

    Article  CAS  PubMed  Google Scholar 

  20. Fujita T, Miyamoto S, Onoyama I, Sonoda K, Mekada E, Nakano H: Expression of lysophosphatidic acid receptors and vascular endothelial growth factor mediating lysophosphatidic acid in the development of human ovarian cancer. Cancer Lett. 2003, 192: 161-169. 10.1016/S0304-3835(02)00713-9.

    Article  CAS  PubMed  Google Scholar 

  21. Pustilnik TB, Estrella V, Wiener JR, Mao M, Eder A, Watt MA, Bast RC, Mills GB: Lysophosphatidic acid induces urokinase secretion by ovarian cancer cells. Clin Cancer Res. 1999, 5: 3704-3710.

    CAS  PubMed  Google Scholar 

  22. Furui T, LaPushin R, Mao M, Khan H, Watt SR, Watt MA, Lu Y, Fang X, Tsutsui S, Siddik ZH, et al: Overexpression of edg-2/vzg-1 induces apoptosis and anoikis in ovarian cancer cells in a lysophosphatidic acid-independent manner. Clin Cancer Res. 1999, 5: 4308-4318.

    CAS  PubMed  Google Scholar 

  23. Huang MC, Graeler M, Shankar G, Spencer J, Goetzl EJ: Lysophospholipid mediators of immunity and neoplasia. Biochim Biophys Acta. 2002, 1582: 161-167. 10.1016/S1388-1981(02)00151-8.

    Article  CAS  PubMed  Google Scholar 

  24. Goetzl EJ, Kong Y, Mei B: Lysophosphatidic acid and sphingosine 1-phosphate protection of T cells from apoptosis in association with suppression of Bax. J Immunol. 1999, 162: 2049-2056.

    CAS  PubMed  Google Scholar 

  25. Swarthout JT, Walling HW: Lysophosphatidic acid: receptors, signaling and survival. Cell Mol Life Sci. 2000, 57: 1978-1985.

    Article  CAS  PubMed  Google Scholar 

  26. Deng W, Balazs L, Wang DA, Van Middlesworth L, Tigyi G, Johnson LR: Lysophosphatidic acid protects and rescues intestinal epithelial cells from radiation- and chemotherapy-induced apoptosis. Gastroenterology. 2002, 123: 206-216. 10.1053/gast.2002.34209.

    Article  CAS  PubMed  Google Scholar 

  27. Howe GR, Hirohata T, Hislop TG, Iscovich JM, Yuan JM, Katsouyanni K, Lubin F, Marubini E, Modan B, Rohan T, et al: Dietary factors and risk of breast cancer: combined analysis of 12 case-control studies. J Natl Cancer Inst. 1990, 82: 561-569. 10.1093/jnci/82.7.561.

    Article  CAS  PubMed  Google Scholar 

  28. Hunter DJ, Spiegelman D, Adami HO, Beeson L, van den Brandt PA, Folsom AR, Fraser GE, Goldbohm RA, Graham S, Howe GR, et al: Cohort studies of fat intake and the risk of breast cancer – a pooled analysis. N Engl J Med. 1996, 334: 356-361. 10.1056/NEJM199602083340603.

    Article  CAS  PubMed  Google Scholar 

  29. Holmes MD, Hunter DJ, Colditz GA, Stampfer MJ, Hankinson SE, Speizer FE, Rosner B, Willett WC: Association of dietary intake of fat and fatty acids with risk of breast cancer. JAMA. 1999, 281: 914-920. 10.1001/jama.281.10.914.

    Article  CAS  PubMed  Google Scholar 

  30. Lipworth L: Epidemiology of breast cancer. Eur J Cancer Prev. 1995, 4: 7-30.

    Article  CAS  PubMed  Google Scholar 

  31. Wynder EL, Cohen LA, Muscat JE, Winters B, Dwyer JT, Blackburn G: Breast cancer: weighing the evidence for a promoting role of dietary fat. J Natl Cancer Inst. 1997, 89: 766-775. 10.1093/jnci/89.11.766.

    Article  CAS  PubMed  Google Scholar 

  32. Stoll BA: Adiposity as a risk determinant for postmenopausal breast cancer. Int J Obes Relat Metab Disord. 2000, 24: 527-533. 10.1038/sj.ijo.0801247.

    Article  CAS  PubMed  Google Scholar 

  33. Bruning PF, Bonfrer JM, van Noord PA, Hart AA, de Jong-Bakker M, Nooijen WJ: Insulin resistance and breast-cancer risk. Int J Cancer. 1992, 52: 511-516.

    Article  CAS  PubMed  Google Scholar 

  34. Gamayunova VB, Bobrov Yu F, Tsyrlina EV, Evtushenko TP, Berstein LM: Comparative study of blood insulin levels in breast and endometrial cancer patients. Neoplasma. 1997, 44: 123-126.

    CAS  PubMed  Google Scholar 

  35. Del Giudice ME, Fantus IG, Ezzat S, McKeown-Eyssen G, Page D, Goodwin PJ: Insulin and related factors in premenopausal breast cancer risk. Breast Cancer Res Treat. 1998, 47: 111-120. 10.1023/A:1005831013718.

    Article  CAS  PubMed  Google Scholar 

  36. Peyrat JP, Bonneterre J, Hecquet B, Vennin P, Louchez MM, Fournier C, Lefebvre J, Demaille A: Plasma insulin-like growth factor-1 (IGF-1) concentrations in human breast cancer. Eur J Cancer. 1993, 29A: 492-497.

    Article  CAS  PubMed  Google Scholar 

  37. Happerfield LC, Miles DW, Barnes DM, Thomsen LL, Smith P, Hanby A: The localization of the insulin-like growth factor receptor 1 (IGFR-1) in benign and malignant breast tissue. J Pathol. 1997, 183: 412-417. 10.1002/(SICI)1096-9896(199712)183:4<412::AID-PATH944>3.3.CO;2-W.

    Article  CAS  PubMed  Google Scholar 

  38. Richert MM, Wood TL: The insulin-like growth factors (IGF) and IGF type I receptor during postnatal growth of the murine mammary gland: sites of messenger ribonucleic acid expression and potential functions. Endocrinology. 1999, 140: 454-461. 10.1210/en.140.1.454.

    CAS  PubMed  Google Scholar 

  39. Ahmad T, Farnie G, Bundred NJ, Anderson NG: The mitogenic action of insulin-like growth factor I in normal human mammary epithelial cells requires the epidermal growth factor receptor tyrosine kinase. J Biol Chem. 2004, 279: 1713-1719. 10.1074/jbc.M306156200.

    Article  CAS  PubMed  Google Scholar 

  40. Chappell J, Golovchenko I, Wall K, Stjernholm R, Leitner JW, Goalstone M, Draznin B: Potentiation of Rho-A-mediated lysophosphatidic acid activity by hyperinsulinemia. J Biol Chem. 2000, 275: 31792-31797. 10.1074/jbc.M004798200.

    Article  CAS  PubMed  Google Scholar 

  41. Dalle S, Imamura T, Rose DW, Worrall DS, Ugi S, Hupfeld CJ, Olefsky JM: Insulin induces heterologous desensitization of G-protein-coupled receptor and insulin-like growth factor I signaling by downregulating beta-arrestin-1. Mol Cell Biol. 2002, 22: 6272-6285. 10.1128/MCB.22.17.6272-6285.2002.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Chappell J, Leitner JW, Solomon S, Golovchenko I, Goalstone ML, Draznin B: Effect of insulin on cell cycle progression in MCF-7 breast cancer cells. Direct and potentiating influence. J Biol Chem. 2001, 276: 38023-38028. 10.1074/jbc.M106008200.

    Article  CAS  PubMed  Google Scholar 

  43. Goetzl EJ, Dolezalova H, Kong Y, Zeng L: Dual mechanisms for lysophospholipid induction of proliferation of human breast carcinoma cells. Cancer Res. 1999, 59: 4732-4737.

    CAS  PubMed  Google Scholar 

Download references

Acknowledgements

This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture of Japan, and a Grant from the Ministry of Health and Welfare of Japan.

Author information

Authors and Affiliations

  1. Department of Surgical Oncology, The University of Tokyo, Tokyo, Japan

    Joji Kitayama, Dai Shida, Akihiro Sako, Makoto Ishikawa & Hirokazu Nagawa

  2. Department of Pharmaceutical Science, The University of Tokyo, Tokyo, Japan

    Kotaro Hama, Junken Aoki & Hiroyuki Arai

Authors
  1. Joji Kitayama
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Dai Shida
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Akihiro Sako
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Makoto Ishikawa
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Kotaro Hama
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Junken Aoki
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Hiroyuki Arai
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Hirokazu Nagawa
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Joji Kitayama.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ original submitted files for images

Rights and permissions

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and permissions

About this article

Cite this article

Kitayama, J., Shida, D., Sako, A. et al. Over-expression of lysophosphatidic acid receptor-2 in human invasive ductal carcinoma. Breast Cancer Res 6, R640 (2004). https://doi.org/10.1186/bcr935

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/bcr935

Keywords

Breast Cancer Research

ISSN: 1465-542X

Contact us