TP53 mutations detected in circulating tumor cells present in the blood of metastatic triple negative breast cancer patients

Patients

Patients with metastatic inflammatory breast cancer (IBC) undergoing systemic treatment for their conditions were evaluated before starting a new treatment. Patients signed informed consent and HIPAA certification from the Human Subject Protection Committee prior to sample collection. This study was approved by both the Research Review Committee (RRC) and Institutional Review Board (IRB) at Fox Chase Cancer Center. The TRF001321 patient was diagnosed with triple-negative IBC in her right breast and invasive ductal carcinoma non-IBC in her left breast in 2011; the patient had a double mastectomy in October 2011 and a breast tumor sample from her right breast was sent for sequencing. The TRF000155 patient was diagnosed with triple-negative IBC in 2008; chest wall skin biopsy was obtained in 2012 and sent for sequencing. Blood from both patients was drawn in 2012 for CTCs studies. Both patients passed away in 2012.

Tumor tissue sample sequencing

Formalin-fixed paraffin embedded (FFPE) tumor tissues (primary breast biopsy/mastectomy and/or chest wall skin 4- to 6-mm punch biopsies) were prepared: 10 (5 to 10 μm) unstained sections were cut and placed on charged slides and submitted to Foundation Medicine (Cambridge, MA, USA) for genetic analysis. DNA was isolated from the fixed cells and genomic analysis was performed using next-generation sequencing (NGS) (Foundation One™). Foundation One™ is a comprehensive, NGS-based, cancer gene test which is routinely applied to FFPE clinical samples. The assay sequences the entire coding sequence of 182 cancer-related genes (3,230 exons) plus 37 introns from 14 genes often rearranged in cancer. Briefly, hybridization capture of 3,230 exons from 182 cancer-related genes and 37 introns of 14 genes commonly rearranged in cancer was applied to ≥50 ng of DNA extracted from FFPE tumor specimens and sequenced to a unique median depth of >800×. Reads were mapped to human genome reference and alignment results were analyzed by customized tools.

Tumor tissue immunohistochemistry

Immunohistochemical staining was performed on 5-μm FFPE sections. The monoclonal mouse anti-human p53 clone DO-7 (Dako, Catalog number M7001) was used according to the manufacturer’s instructions. Briefly, after deparaffinization and rehydration, sections were subjected to heat-induced epitope retrieval by steaming in 0.01 M citrate buffer (pH 6.0) for 20 minutes. After endogenous peroxidase activity was quenched with 3% hydrogen peroxide for 20 minutes and nonspecific protein binding was blocked with goat serum, sections were incubated overnight with primary antibodies to TP53 (Dako, DO-7, mouse, 1:200) at 4°C, followed by biotinylated goat anti-mouse IgG (LSAB kit, Dako) for 30 minutes. The sections were rinsed in PBS and then incubated with horseradish peroxidase-labeled streptavidin-biotin complex for 30 minutes. The sections were then visualized with the chromogen 3, 3′-diaminobenzidine (DAB) containing 0.05% hydrogen peroxide and then lightly counterstained with Mayer’ hematoxylin. As a negative control, the primary antibody was replaced with mouse non-immunized IgG. A positive TP53 ovarian tumor was used as control.

Blood samples

One tube of 7.5 ml blood from the patients with metastatic breast cancer was drawn into CellSave Preservative tubes (Veridex, LLC) for CTC enrichment and enumeration. The schematic representation of the procedure that was followed to isolate a single CTC is shown in Figure 1. The CellSearch™ System was used to determine if CTCs were present in the patients’ blood and the resulting sample served as a primary enrichment of CTC that was used for single-cell selection using the DEPArray™ System (Silicon Biosystems, San Diego, CA, USA).

Immuno-magnetic enrichment and enumeration of CTCs

Standard protocols and reagents for CTC enrichment and enumeration using the Food and Drug Administration (FDA)-approved CellSearch™ system (Veridex LLC) - CellTracks Autoprep and CellTracks Analyzer II - were employed. Blood samples were collected as indicated before and processed according to the manufacturer’s instructions using the CellSearch CTC kit (Veridex LLC). Briefly, CTCs were enriched on the CellTracks Autoprep using ferrofluid conjugated with anti-epithelial cell adhesion molecule (EpCAM) antibody. Captured cells were stained with fluorescently labeled monoclonal antibodies specific for pan cytokeratin (CK-8/18/19-phycoerythrin (PE)), leukocyte common antigen (CD45-allophyocyanin (APC)), and nuclear-stained (with (4′, 6 diamidino 2 phenylindole (DAPI)). Captured cells were automatically loaded by the system into a cartridge held within a MagNest magnetic holder which was then placed in the CellTracks Analyzer II. Serial pictures were taken and frames were analyzed using computer-assisted software to determine if the events expressed cytokeratin-phycoerythrin (PE) and DAPI staining. Tumor cells were defined using standard CellSearch CTC criteria, these being: round to oval shape, presence of a clear DAPI-stained nucleus, at least 50% overlap between the CK-PE-positive cytoplasm and the nucleus, and CD-45-APC negative. Patient samples containing a minimum of 30 CTCs were prepared for single-cell selection using DEPArray™ (Silicon Biosystems, San Diego, CA, USA).

Sample transfer from CellSearch to DEPArray™ cartridges

Cells were removed from the cartridges and transferred into a Protein LoBind tube (Eppendorf) and the cartridge was washed twice with elution buffer and all samples combined. The samples were centrifuged at 600 × g for 5 minutes and the supernatant was carefully removed. The cell pellets were stored and protected from light at 4°C in a residual volume of elution buffer until use. This procedure was performed on the same day the sample was run on the CellTracks, as delaying removal of cells from the cartridge decreased the number of CTCs recovered.

Isolation of single CTCs

After the CellSearch enrichment, the CTCs were selected and isolated using the DEPArray™ (Silicon Biosystems) (Figure 1B). The system is an automated platform that uses dielectrophoresis and a high-quality image-based cell selection system that allows for the identification and recovery of individual cells from heterogeneous samples. The DEPArray™ chip consists of various microelectrodes that create electric cages into which individual cells are trapped and, by alternatively activating and deactivating the microelectrodes, the cells are moved to a position in the chip that allows their recovery. Briefly, DEPArray™ cartridges (DEPArray™ A300K-cartridge, Silicon Biosystems) were loaded with 800 μl of SB115 buffer and 14 μl of sample, placing approximtely 9.26 μl of sample within the electrophoretic chamber. Upon the application of a preprogrammed electric field, cells moved to and were held within their nearest electrically controlled cages. The cartridges allowed for either 16,000 or 40,000 cells to be trapped. Images of each cage were captured with white light exposure and each of three fluorescent filter cubes (PE, APC, and DAPI/Hoechst). Cells were automatically detected by the system based on a DAPI/ Hoechst fluorescence threshold and assigned a unique cell ID. Captured images were digitally processed using multiple parameters outlined by the operator and presented in a software module that enables selection of cells of interest.

Next, in the recovery step, selected cells were electrically moved to a parking area adjacent to the main microchamber in the cartridge (Figure 1). Finally, individual cells were moved from the parking area for recovery and flushed from the chamber with three drops of SB115 buffer (30 to 40 μl) into a 200-μl PCR tube. The entire cell-routing process was monitored under bright field imaging. Routing and paths were automatically calculated by the software and routing parameters, such as speed, can be manually adjusted by the operator. A cell pellet was prepared as recommended by the supplier. Briefly, the tubes were spun at 14,000 × g for 10 minutes, 100 μl PBS was added and the sample was centrifuged again for 25 minutes. The buffer was removed from the tube and the cell pellets were stored at −80°C until further use for whole genome amplification (WGA). Individual CTCs or clusters, classified as α-cytokeratin (PE)-positive, CD45 (APC)-negative and DAPI-positive cells, were recovered in several tubes for genomic analysis. Also, individual white blood cells (WBCs) classified as CD45 (APC)-positive, CK (PE)-negative, and DAPI-positive cells, were selected and recovered as single cells to use as controls in the genomic studies.

Whole genome amplification (WGA)

To allow genotyping analysis of single CTCs, WGA was performed using the Ampli1™ WGA Kit (Silicon Biosystems). The Ampli1™ WGA kit uses a polymerase with proofreading activity with a lower error rate (4.8 × 10⁻⁶) with respect to standard Taq DNA polymerases. The isolated CTCs were thawed on ice and brought up to a volume of 1 μl for the WGA procedure; single WBCs were also subjected to WGA in order to use as controls for TP53 analysis. Global amplification consisting of DNA isolation, restriction digestion, adaptor ligation and PCR amplification were performed as recommended by the supplier. Briefly, cells were lysed overnight and then digested with MseI restriction enzyme; adapters were ligated onto the digested DNA and fragments were then amplified by PCR with time and temperature gradients using adapter specific primers; the final volume of the sample after amplification was 50 μl. As control for the WGA, products were subjected to an end-point PCR for two control genomic DNA sequences of 373 and 167 bp (Figure 1B), respectively (Ampli1™ QC kit; SB); 2 μl of the Amli1™ WGA product was used as template per reaction and PCR products were analyzed by gel electrophoresis on the Agilent 2100 Bioanalyzer using the DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA). Only samples that showed both bands were used to study TP53 exon 4.

TP53 exon 4 amplification

The primers, reverse 5′ AGGCATTGAAGTCTCAGGAAG 3′ and, forward 5′CAATGGATGATTTGATGCTGTC 3′, were used to amplify a 304-bp region of TP53 exon 4 in the CTCs. The same reverse primer (5′ AGGCATTGAAGTCTCAGGAAG 3′) and the forward primer, 5′ CCTTCCCAGAAAACCTACCAG 3′, were also used to amplify a 128-bp of this TP53 region and confirmed the sequences. PCR reactions were performed using 2 μl of the Amli1™ WGA product, GoTaq (Promega), 2 μM primers, and 52°C as the annealing temperature. The PCR products were cleaned using the QIAquick PCR purification kit and sequenced using the ABI 3130XL capillary genetic analyzer. TP53 exon 4 was also amplified using as templates the WGA products obtained from single WBCs; the amplified region from WBCs were used as controls of TP53 wild-type allele. PCR products were sequenced in the ABI 3130XL capillary genetic analyzer and sequences were analyzed using the Sequencher software.

Cloning

PCR products obtained from a pool of cells were cloned using TOPO-TA Cloning Kit for Sequencing (Life Technologies) according to the manufacturer's instructions. The product of the ligation reaction was transformed into Escherichia coli DH5α, plated on Luria Bertani agar plates and selected with 100 μg/ml of ampicillin. Ten colonies were picked and grown in Luria Bertani media in the presence of ampicillin. Plasmid extractions were done using the Wizard Plus SV Miniprep Purification Kits (Promega) and the inserts were sequenced in the ABI 3130XL capillary genetic analyzer and sequences were analyzed using the Sequencher software as described before.

Mutation analysis of tissue samples from metastatic breast cancer patients

Two patients with metastatic triple-negative (estrogen receptor (ER)-negative, progesterone receptor (PgR)-negative, HER2/neu-negative) inflammatory breast cancer were included in this study. NGS-based cancer gene test (Foundation One™) was used to detect genomic alterations in breast tumor and skin biopsies of the patients. The TP53 R110 fs*13 mutation was detected in both breast and chest wall skin biopsies of both IBC patients. TP53 R110 fs*13 is a frame shift deleterious mutation that produced a stop codon at position 122 (nucleotide 366) of TP53 with the loss of the protein. In patient TRF001321, a G deletion was detected (nucleotide 329, delG) in the breast tumor sample and, in TRF000155 a C deletion (nucleotide 328, delC) was detected in the chest wall skin biopsy by NGS. The invasive ductal carcinomas present in the dermis and lymphatic system from both patients were negative for TP53 immunohistochemical stains (Figure 2); scattered cells in the epidermis were positive for TP53 (not shown). Patient TRF000155 also had mutations in BRCA2 (BRCA2 A1327 fs*4) and RB1 (RB1 F720 > *) and amplification of MYC and CCNE1 (cyclin E1) by NGS of her tissue biopsies. The sample of patient TRF001321 did not show mutations other than in TP53; however, it showed amplification of MYC, MCL1 (myeloid cell leukemia sequence 1) and JUN.

Circulating tumor cell (CTC) in patients with triple-negative metastatic breast cancer

CTCs were isolated from the blood of the same patients in which mutations in the breast tissue biopsies were studied. The total number of CTCs was high for both patients: patient TRF001321 had 222 CTC/7.5 ml of blood and patient TRF000155 had 45 CTC/7.5 ml of blood. The CTCs from patient TRF001321 were seen as individual cells when visualized in the DEPArray system (Figure 3); six single CTC and a pool of fourteen CTCs were recovered from this patient. The second IBC patient, TRF000155, had a mixed population of single CTCs and clusters of two to six CTCs (Figure 4); from this patient, five single CTC and six clusters were recovered for molecular analysis. Single WBCs were also isolated from both patients to use as controls in the molecular studies of TP53; four single WBCs were isolated from patient TRF001321 (WBC in Figure 3) and nine single WBCs were isolated from patient TRF000155 (WBC in Figure 4).

Mutation analysis of TP53 in CTCs

A total of four WBCs as control, six single CTCs and a pool of fourteen CTCs were isolated from patient TRF001321 (Figure 3). The region of TP53 exon 4 that was found mutated in the matching tissue samples was studied in these cells. In patient TRF001321, from six single CTCs isolated, one exhibited the same TP53 R110 delG mutation (Figure 5: cell_id = 50) found in the breast tumor tissue and one showed a TP53 R110 delC mutation (Figure 5: cell_id = 4994); the remaining four single CTCs contained the wild-type TP53 sequence (Figure 5: cell_id = 2597, 2319, 2310, 2424). The same region of TP53 exon 4 was amplified from a pool of 14 CTCs and the PCR product was cloned into the pCR4-TOPO vector (Life Science); 10 independent clones were selected for sequencing and all showed the TP53 R110 delC mutation. The four WBCs (Figure 5, cell_id = 5022, 4940, 4907, 33) studied from the same patient showed the wild-type TP53 allele, indicating lack of mutation in the germline DNA.