Open Access

Erratum to: Claudin-1, -3 and -4 proteins and mRNA expression in benign and malignant breast lesions: a research study

  • Anna-Mária Tőkés1,
  • Janina Kulka1Email author,
  • Sándor Paku2,
  • Ágnes Szik1,
  • Csilla Páska1,
  • Pál Kaposi Novák1,
  • László Szilák1,
  • András Kiss1,
  • Krisztina Bögi1 and
  • Zsuzsa Schaff1
Breast Cancer Research20057:162

https://doi.org/10.1186/bcr1265

Published: 11 May 2005

The original article was published in Breast Cancer Research 2005 7:R296

After publication of this work [1], it was brought to our attention that two corrections were required in the first table. First, the Claudin 1 forward and reverse primer sequences were the same. Second, the forward and reverse primer sequences of GAPDH were inversed.

The correct sequences can be found in Table 1.
Table 1

The CLDN1, CLDN3, CLDN4 and GAPDH primer sequences, position and product size

Primer

Forward

Reverse

Product size (bp)

GI number

 

Sequence 5'–3'

Position (bp)

 

Sequence 5'–3'

Position (bp)

   

CLDN1

gcgcgatatttcttcttgcagg

378–399

22

ttcgtacctggcattgactgg

470–490

21

112

4559277

GAPDH

gaaggtgaaggtcggagt

81–98

20

gaagatggtgatggatttc

287–306

18

225

7669491

bp, base pairs; CLDN, claudin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Notes

Authors’ Affiliations

(1)
2nd Department of Pathology, Semmelweis University
(2)
Department of Molecular Pathology, Joint Research Organization of the Hungarian Academy of Sciences

References

  1. Tőkés A-M, Kulka J, Paku S, Szik A, Páska C, Novák PK, Szilák L, Kiss A, Bögi K, Schaff Z: Claudin-1, -3 and -4 proteins and mRNA expression in benign and malignant breast lesions: a research study. Breast Cancer Res. 2005, 7: R296-R305. 10.1186/bcr983.View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

© Tőkés et al., licensee BioMed Central Ltd. 2005

Advertisement