Skip to main content

Table 2 Oligonucleotide sequences used in this study

From: Breast cancer bone metastases are attenuated in a Tgif1-deficient bone microenvironment

Target gene Sense Antisense
mGFP CAGGAGCGCACCATCTTCTT CTCGATGTTGTGGCGGATCT
mB2M CTGCTACGTAACACAGTTCCACCC CATGATGCTTGATCACATGTCTCG
mTgif1 GAGGATGAAGACAGCATGGA TTCTCAGCATGTCAGGAAGG
mSema3E GGGGCAGATGTCCTTTTGA AGTCCAGCAAACAGCTCATTC
mGAPDH TCACCACCATGGAGAAGGC GCTAAGCAGTTGGTGGTGCA