Skip to main content

Table 1 Sequences for primers used in the real-time PCR assays and guide RNA sequences and screening primer sequences for CRISPR experiments

From: INHBA is a mediator of aggressive tumor behavior in HER2+ basal breast cancer

Primers Sequence (5′ to 3′) Purpose
  AAGTCGGGGAGAACGGGTATG RT-qPCR
INHBA-R TCTTCCTGGCTGTTCCTGAC RT-qPCR
B2M-F
INHBA-F
TGCTGTCTCCATGTTTGATGT RT-qPCR
B2M-R TCTCTGCTCCCCACCTCTAAGT RT-qPCR
sgRNA275 FOR CACCGCGCGATCAGAAAGCTTCATG Guide RNA for CRISPR
sgRNA275 REV AAACCATGAAGCTTTCTGATCGCGC Guide RNA for CRISPR
sgRNA95 FOR CACCGCGCACAGGACGGACAGTCGG Guide RNA for CRISPR
sgRNA95 REV AAACCCGACTGTCCGTCCTGTGCGC Guide RNA for CRISPR
g95-surveyor-F1 ACAGCCACAAACCTACAGCAC Competition-based PCR
g95-surveyor-R1 TCCACATACCCGTTCTCCCC Competition-based PCR
g95-surveyor-F2 CCCTTGCTTTGGCTGAGAGG Competition-based PCR
g95-surveyor-R2 CAATGCCAGCACCAACCTGA Competition-based PCR
g275-surveyor-F1 TCAGCCAGAGATGGTGGAGG Competition-based PCR
g275-surveyor-R1 GTGTGACCCGCTGGGTTTAG Competition-based PCR
g275-surveyor-F2 GATGCCCTTGCTTTGGCTGA Competition-based PCR
g275-surveyor-R2 CAATGCCAGCACCAACCTGA Competition-based PCR
g95-F-in AGCGCGGCCCCCGACT Competition-based PCR
g95-R-in GCACAGGACGGACAGTCGG Competition-based PCR
g275-F-in GAACGCGATCAGAAAGCTTCATG Competition-based PCR
g275-R-in CCCGACTTTGCCCACATGAA Competition-based PCR