Skip to main content

Table 3 Sequences of siRNA used in the current study

From: Integrin alpha-2 and beta-1 expression increases through multiple generations of the EDW01 patient-derived xenograft model of breast cancer—insight into their role in epithelial mesenchymal transition in vivo gained from an in vitro model system

siRNA constructs siRNA sequence
ITGB1 siRNA AAGCTTTTAATGATAATTCAT
ITGA2 siRNA TCGCTAGTATTCCAACAGAAA
ILK siRNA CCTGACGAAGCTCAACGAGAA