Skip to main content

Table 2 QPCR primers for various genes examined in this study

From: Integrin alpha-2 and beta-1 expression increases through multiple generations of the EDW01 patient-derived xenograft model of breast cancer—insight into their role in epithelial mesenchymal transition in vivo gained from an in vitro model system

Oligonucleotide name Species Sequence (5′-3′)
5′ Hs L32 Human CAGGGTTCGTAGAAGATTCAAGGG
3′Hs L32 Human CTTGGAGGAAACATTGTGAGCGATC
Hs L32 RT Human CAGAAAACGTGCACATGAGCTGC
5′ Hs CD24 Human GACTCAGGCC AAGAAACGTC TTCTAAA
3′ Hs CD24 Human GTTGCCTCTCCTTCATCTTG TACATGAAA
Hs CD24 RT Human GGGCGACAAAGTGAGACTGTCTAAAA
5′ Hs CD44 Human CACAATGGCCCAGATGGAGAAA
3′ Hs CD44 Human CTTCGACTGTTGACTGCAATGCAAA
Hs RT CD44 Human GGCAATGTTGCAAGGGTTTGTGAAGACTT
5′ Hs VIM Human CAGGCGATATATTACCCAGGCAAGAA
3′ Hs VIM Human CTTGTAGGAGTGTCGGTTGTTAAGAA
Hs VIM RT Human CTAAATCTTGTAGGAGTGTCGGTTGTT
5′ Hs CDH1 Human GGCACAGATGGTGTGATTACAGTCAAAA
3′ Hs CDH1 Human GTCCCAGGCGTAGACCAAGAAA
Hs CDH1 RT Human CTCTGTCTTTGGCTGCAGCACTTTA
5′ Hs ILK Human GATGCAGGACAAGTAGGACTGGAA
3′ Hs ILK Human CAACCAGAGGCCTGCTGCTTT
Hs ILK RT Human GCTGGGGTAGTACCATGACTG
5′ Hs TWIST1 Human CTAGAGACTCTGGAGCTGGATAACTAAAAA
3′ Hs TWIST1 Human CGACCTCTTGAGAATGCATGCATGAAAAA
Hs TWIST1 RT Human GAGAAAGTCCATAGTGATGCCTTTCCTTT
5′ Hs SNAI1 Human CCAGACCCACTCAGATGTCAAGAA
3′ Hs SNAI1 Human GGCAGAGGACACAGAACCAGAAAA
Hs SNAI1 RT Human CGCAGACAGGCCAGCTCAGGAAT
5′ Hs SNAI2 Human CCCAATGGCCTCTCTCCTCTTT
3′ Hs SNAI2 Human CATCGCAGTGCAGCTGCTTATGTTT
Hs SNAI2 RT Human CATCGCAGTGCAGCTGCTTATGTTT
5′ Hs ZEB1 Human GTTACCAGGGAGGAGCAGTGAAA
3′ Hs ZEB1 Human GACAGCAGTGTCTTGTTGTTGTAGAAA
Hs ZEB1 RT Human GACAGCAGTGTCTTGTTGTTGTAGAAA
5′ Hs ZEB2 Human CCACCTGGAACTCCAGATGCTTTT
3′ Hs ZEB2 Human GCCTTGCCACACTCTGTGCATTT
Hs ZEB2 RT Human GCCTTGCCACACTCTGTGCATTT
5′ Hs ITGA2 Human GACCTATCCACTGCCACATGTGAAAAA
3′ Hs ITGA2 Human CCACAGAGGACCACATGTGAGAAAA
Hs ITGA2 RT Human GTCAGAACACACACCCGTTGTGTAATA
5′ Hs ITGB1 Human GACTGATCAGTTCAGTTTGCTGTGTGTTT
3′ Hs ITGB1 Human CCCTGCTTGTATACATTCTCCACATGATTT
Hs ITGB1 RT   CCCTGCTTGTATACATTCTCCACATGATTT
5′ Ms. ITGB1 Mouse GCGTGTGCAGGTGTCGTGTTT
3′ Ms. ITGB1 Mouse GAAGGCTCTGCACTGAACACATTCTTT
Ms ITGB1 RT Mouse GAAGGCTCTGCACTGAACACATTCTTT