Skip to main content

Table 1 Primers used for the qPCR and their sequence

From: Apolipoprotein-mediated regulation of lipid metabolism induces distinctive effects in different types of breast cancer cells

Gene (protein)Forward primerReverse primer
ABCA1 (ABCA1)ACCCACCCTATGAACAACATGAGAGTCGGGTAACGGAAACAGG
ABCG1 (ABCG1)CAGGAAGATTAGACACTGTGGGAAAGGGGAATGGAGAGAAGA
APOA1 (ApoA-I)AGCTTGCTGAAGGTGGAGGTATCGAGTGAAGGACCTGGC
APOE (ApoE)GGTCGCTTTTGGGATTACCTCATGGTCTCGTCCATCAGC
CAV1 (caveolin-1)ACCCACTCTTTGAAGCTGTTGGAACTTGAAATTGGCACCAGG
CDH1 (E-cadherin)TACGCCTGGGACTCCACCTACCAGAAACGGAGGCCTGAT
FN1 (fibronectin)CATCGAGCGGATCTGGCCCGCAGCTGACTCCGTTGCCCA
GAPDH (GAPDH)TGGTCTCCTCTGACTTCAACAAGCCAAATTCGTTGTCATACC
HMGCR (HMGCR)GTTCGGTGGCCTCTAGTGAGGCATTCGAAAAAGTCTTGACAAC
LDLR (LDLR)GATAGTGACAATGTCTCACCAAGCCTCACGCTACTGGGCTTC
CDH2 (N-cadherin)GGCGTTATGTGTGTATCTTCACTGGCAGGCTCACTGCTCTCATA
SNAIL2 (SNAIL2)AGACCCTGGTTGCTTCAAGGACTCAGATTTGACCTGTCTGCAAA
SCARB1 (SR-BI)CGGCTCGGAGAGCGACTACGGGCTTATTCTCCATGATCACC
VIM (vimentin)GGCTCGTCACCTTCGTGAATGAGAAATCCTGCTCTCCTCGC
VLDLR (VLDLR)GGAGAAGATGAAGAAAACTGTGGCATCCTGGCCATTGCATAC
ZEB1 (ZEB1)GAAAATGAGCAAAACCATGATCCTCCCTGCCTCTGGTCCTCTTC