Skip to main content

Advertisement

Table 1 siRNA sequences used in this study

From: Rack1 mediates tyrosine phosphorylation of Anxa2 by Src and promotes invasion and metastasis in drug-resistant breast cancer cells

Name Sequence
siRack1-1# Upper: UAUCUCGAGAUCCAGAGACAAUCUG
Lower: CAGAUUGUCUCUGGAUCUCGAGAUA
siRack1-2# Upper: ACGAUGAUAGGGUUGCUGCUGUUGG
Lower: CCAACAGCAGCAACCCUAUCAUCGU
siSrc-1# Upper: CAGCAGCUGGUGGCCUACUACUCCA
Lower: UGGAGUAGUAGGCCACCAGCUGCUG
siSrc-2# Upper: GAGCCCAAGCUGUUCGGAGGCUUCA
Lower: UGAAGCCUCCGAACAGCUUGGGCUC
siAnxa2-1# Upper: UACAGCAGCGCUUUCUGGUAGUCGC
Lower: GCGACUACCAGAAAGCGCUGCUGUA