Skip to main content

Table 3 Gene-specific primer sequences

From: A novel neuregulin – jagged1 paracrine loop in breast cancer transendothelial migration

Gene Sequence
Mouse NRG1 F: ATAAAGTGTCGCGAGAAGGAG
R: GTAGTTTTGGCAACGATCACC
Human NRG1 F: CACTATACTTCCACAGCCCATC
R: TGTGCCTACTGTTTTCTACGG
Mouse GAPDH F: CTGGAGAAACCTGCCAAGTA
R: TGTTGCTGTAGCCGTATTCA
Human GAPDH F: ACATCGCTCAGACACCATG
R: TGTAGTTGAGGTCAATGAAGGG
  1. NRG1 neuregulin, GAPDH glyceraldehyde-3-phosphate dehydrogenase