Skip to main content

Table 2 Jagged 1 (JAG1) clustered regularly interspaced short palindromic repeats (CRISPR) guide sequences

From: A novel neuregulin – jagged1 paracrine loop in breast cancer transendothelial migration

Target Sequence
Non-targeting guide GCACTACCAGAGCTAACTCA
JAG1-specific guide CAGTCCCGCGTCACTGCCGG
\