Skip to main content

Table 1 Primers used for real-time quantitative reverse transcription-polymerase chain reaction

From: Concurrent antitumor and bone-protective effects of everolimus in osteotropic breast cancer

Targeted gene Primer sequences (5′-3′)
ACTB CCAACCGCGAGAAGATGA
CCAGAGGCGTACAGGGATAG
ALP CAACCCTGGGGAGGAGAC
GCATTGGTGTTGTACGTCTTG
OPG GAACCCCAGAGCGAAATACAG
TAGCAGGAGACCAAAGACACTG
RUNX2 CAGATGGGACTGTGGTTACTG
TGGGGAGGATTTGTGAAGAC
OCN TGAGAGCCCTCACACTCCTC
ACCTTTGCTGGACTCTGCAC
Actb GATCTGGCACCACACCTTCT
GGGGTGTTGAAGGTCTCAAA
Alp CTACTTGTGTGGCGTGAAGG
CTGGTGGCATCTCGTTATCC
Opg CCTTGCCCTGACCACTCTTA
ACACTGGGCTGCAATACACA
Runx2 CCCAGCCACCTTTACCTACA
TATGGAGTGCTGCTGGTCTG
Ocn GCGCTCTGTCTCTCTGACCT
ACCTTATTGCCCTCCTGCTT
Rankl CACTGAGGAGACCACCCAAG
GAGATGAAGAGGAGCAGAACG
Oscar TCTGCCCCCTATGTGCTATC
CTCCTGCTGTGCCAATCAC
Trap ACTTGCGACCATTGTTAGCC
AGAGGGATCCATGAAGTTGC
Ctsk AAGTGGTTCAGAAGATGACGGGAC
TCTTCAGAGTCAATGCCTCCGTTC
  1. Abbreviations: ACTB/Actb β-Actin, ALP/Alp Alkaline phosphatase, Ctsk Cathepsin K, OCN/Ocn Osteocalcin, OPG/Opg Osteoprotegerin, RANKL/Rankl Receptor activator of nuclear factor-κB ligand, RUNX2/Runx2 Runt-related transcription factor 2, TRAP/Trap Tartrate-resistant acid phosphatase