Skip to main content

Advertisement

Table 3 Primers used in this study

From: Epithelial requirement for in vitro proliferation and xenograft growth and metastasis of MDA-MB-468 human breast cancer cells: oncogenic rather than tumor-suppressive role of E-cadherin

Primer name Nucleotide sequence
L32 RT sequence CAGAAAACGTGCACATGAGCTGC
Forward sequence (outer nested) CAGGGTTCGTAGAAGATTCAAGGG
Reverse sequence (outer nested) CTTGGAGGAAACATTGTGAGCGATC
Forward sequence (inner nested) GATCTTGATGCCCAACATTGGTTATG
Reverse sequence (inner nested) GCACTTCCAGCTCCTTGACG
Carbonic Anhydrase 9 (for hypoxia validation) Random priming used  
Forward CCTCAAGAACCCCAGAATAATGC
Reverse CCTCCATAGCGCCAATGACT
E-cadherin RT sequence GTCAGCCAGCTTCTTGAAGCGATT
Forward sequence GCCCTGCCAATCCCGATGAAA
Reverse sequence GGGGTCAGTATCAGCCGCT
Vimentin RT sequence CCGTGAGGTCAGGCTTGGAAA
Forward sequence GCTTCAGAGAGAGGAAGCCGAAAA
Reverse sequence CCGTGAGGTCAGGCTTGGAAA
Endogenous E-cadherin (CDH1-3′UTR) RT sequence GCACTTGGGGATTCTGGGCTTT
Forward sequence GTGCCTAAAGTGCTGCAGCCAAA
Reverse sequence GTACAAACCACGGATCTTGTGTCAGAAA
Exogenous E-cadherin (for 468-CDH1 construct) RT sequence GAAAGGACAGTGGGAGTGGCACTTT
Forward sequence CCTGAACTCCTCAGAGTCAGACAAA
Reverse sequence GTGGCACCTTCCAGGGTCAAGGAA
E-cadherin shRNA (for 468-shCDH1 constructs) RT sequence CCAGCTCAGCCCGAGTGGAAAT
Forward sequence CCTCCCATCAGCTGCCCAGAAAA
Reverse sequence CTCTGTCACCTTCAGCCATCCTGTTT
Snail 1 RT sequence CGCAGACAGGCCAGCTCAGGAAT
Forward sequence CACATCCTTCTCACTGCCATGGAATT
Reverse sequence GCTGCCCTCCCTCCACAGAAAT
Estrogen Receptor 1 RT sequence CCAGGGCCACGCTGGGAAATGAA
Forward sequence GTTCCAGTGGGCACTGTACTTGGATCTT
Reverse sequence CAGCTCCATGCCCCAGGGCTAAAT
  1. Abbreviations: RT reverse transcription, shRNA Short hairpin RNA