Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Methylation probe characteristics of the methylation-specific multiplex ligation-dependent probe amplification assay (ME053 BRCA1-BRCA2 X1-0914; MRC-Holland)

From: BRCA promoter methylation in sporadic versus BRCA germline mutation-related breast cancers

Gene Probe ID Length Chromosome position 5′ Probe 3′ Probe Start End CpG site CpG loci ID
BRCA1 BRCA1.1 165 17q21.31 CCTCTGAGAGGCTGCTGCTTAGCGGTAGCCCCTT GGTTTCCGTGGCAACGGAAAAGCGCGGGAATTACAGA 41277415 41277483 41277429 cg04110421
BRCA1 BRCA1.2 230 17q21.31 CATGCATCTGAGAAACCCCACAGCCTGTCCCCCGTCCAGGAA GTCTCAGCGAGCTCACGCCGCGCAGTCGCAGTTT 41277407 41321886 41277395 cg16630982
BRCA1 BRCA1.3 252 17q21.31 GTGGGGTTTCTCAGATAACTGGGCCCCTGC GCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAGGT 41277286 41277352 41277323 cg08993267
BRCA2 BRCA2.1 130 13q13.1 CCATCTTGTGGCGCGAGCTTCTGAAACTA GGCGGCAGAGGCGGAGCCGCTGTGGCACTGCT 32889614 32889670 32889621 N/A
BRCA2 BRCA2.2 149 13q13.1 TGCGGGTTAGTGGTGGTGGTAGTGGGTT GGGACGAGCGCGTCTTCCGCAGTCCCAGTCCAGCGTGG 32889801 32889865 32889836 N/A
BRCA2 BRCA2.3 160 13q13.1 CCTCTGAGAGGCTGCTGCTTAGCGGTAGCCCCTT GGTTTCCGTGGCAACGGAAAAGCGCGGGAATTACAGA 32889665 32889746 32889672 + 32889683 N/A
BRCA2 BRCA2.4 217 13q13.1 CTTCCGGGTGGTGCGTGTGCTGCGTGTCGC GTCACGGCGTCACGTGGCCAGCGCGGGCTTGT 32889557 32889618 2889608 N/A
  1. N/A Not available
  2. The chromosomal locations are based upon GRCh37/hg19. The first nucleotides of the 5′ probe may not be complementary to the target DNA, because it contains the stuffer sequence. The CpG loci ID are as determined by the Infinium HumanMethylation450 BeadChip Array (Illumina, San Diego, CA, USA)