Skip to main content

Table 2 Primer sequences and methylation-sensitive high-resolution melting (MS-HRM) conditions

From: Applicability of HIN-1, MGMT and RASSF1A promoter methylation as biomarkers for detecting field cancerization in breast cancer

Gene Primer sequences Additional MgCl2 concentration (mM) Ta (°C) Amplicon length (bp) Number of CpGs LOD / LOQ (%) Reference
CCND2 F: 5′ GTTTTAGAGCGGAGAAGAG 3′ 0 50 89 4 0.1 / 0.3 In-house
R: 5′ AACAAAACCTCGAAACTACC 3′
DAPK1 F: 5′ GCGCGGAGTTGGGAGGAG 3′ 0 57 70 7 0.2 / 0.9 [23]
R: 5′ CTCCGAACTACCCTACCAAACC 3′
GSTP1 F: 5′ GTGAAGCGGGTGTGTAAGTTT 3′ 1 56 120 12 0.9 / 3.3 [24]
R: 5′ TAAACAAACAACAAAAAAAAAACC 3′
HIN-1 F: 5′ GCGAGGATCGGGTATAAGAAGTT 3′ 2 55 133 12 0.3 / 1.4 [25]
R: 5′ CACCGAAACATACAAAACAAAACCA 3′
MGMT F: 5′ TTGATTAGGGGAGCGGTATTAG 3′ 2 52 140 14 0.9 / 3.0 In-house
R: 5′ CCACATACCCGAATAATCCTAAAA 3′
RASSF1A F: 5′ GTCGGGGTTTGTTTTGTGGTT 3′ 2 56 118 9 1.5 / 5.3 In-house
R: 5′ CAACTCCCACAACTCAATAAACT 3′
  1. T a annealing temperature, bp base pair, CpG cytosine-phosphatidyl-guanosine, LOD limit of detection, LOQ limit of quantification