Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 PCR primer sequences and allele specific probe sequences used to genotype the five haplotypes tagging SNPs

From: Common ataxia telangiectasia mutated haplotypes and risk of breast cancer: a nested case–control study

Single nucleotide polymorphism Primer/Probe sequence
Primers used for PCR  
   SNP1, F1 5'-AGCATAGCCGGGTCCAATAA-3'
   SNP1, R1 5'-CCCGGCTTGTATTGGGTAAG-3'
   SNP2, F2 5'-CAGAAGAGTATTTAGAAGGGCTGCTT-3'
   SNP2, R2 5'-AGGTCACAGATGACAAACATCAAAA-3'
   SNP3, F5 5'-GGAAGACTTTATTTTTTTTCTTACCAGGTA-3'
   SNP3, R5 5'-AGCAGTGCTCTTCACATCAGTGA-3'
   SNP4, F3 5'-GGAGGACACTCAAAACAGCATTAAA-3'
   SNP4, R3 5'-TTAGCAGATTTAGTTTCAGGACACGTA-3'
   SNP5, F4 5'-CCAGAGCAGTTAGCTGTTCTGAACT-3'
   SNP5, R4 5'-GAGCAAGTAGCTTTAGGTCGTAAATTTT-3'
FAM-labeled allele-specific probes  
   SNP1 CCTCCATCCCGCG
   SNP2 TGTCAGCGTATTAAA
   SNP3 TTCCTGATGAGATACAC
   SNP4 AATAGAGAGATTTTGGTTCT
   SNP5 CATGATGAATTTCTG
VIC-labeled allele-specific probes  
   SNP1 CCCTCCTTCCCGC
   SNP2 TGTCAGAGTATTAAAAAT
   SNP3 TTCCTGACGAGATACA
   SNP4 AATAGAGCGATTTTGG
   SNP5 CATGAGGAATTTC