Skip to main content

Table 2 Primers used to amplify exons and splice junctions of EP300

From: No germline mutations in the histone acetyltransferase gene EP300 in BRCA1 and BRCA2 negative families with breast cancer and gastric, pancreatic, or colorectal cancer

Exon Forward1 Reverse Product size (base pairs) Predicted melt temperature (°C)2
1 Atttcctgaggattctggtt cgcaccgagtagaaaagat 202 57,62
2a gacctttgtcttttcccttt accctgatttggtccacta 372 60
2b aggcaggcttgacttctc gcacacaaaccaaaactgta 372 60
3 ttgcttattttgttttcttttg atgccagtttgaaaacaagt 254 52,57
4 agcacattatgactcctaccatt acagtaaccctgtgggtcc 333 57,62
5 cattaacctgctcttgaaaaa actggtgagactttaaaactt 210 57
6 ttctcaccagcattaatttgt tgacacaaccaataccatgt 335 5560
7 tgtctcctgttatttcattttg tgtaatgtgacccagggtat 161 57
8 aactatttggtgaccccttt gaatgagacgtgtccacaat 193 54,59
9 aaatgctgacatgatattacagtgg ccacaacaggttcaatcttgg 212 58
10 tgttacctggtggtagttcc caaacagaaatataacaaaaacca 266 58,53
11 aatattttgtggggtttgtg gtacaccggggattctttta 215 58,53
12 aatttcacaaaggcattcag aggtaaaggccaaagagatt 196 55,60
13 gaagcagtttggtgatttgt tgaaaaatccacttatgagaca 201 55,60
14a tgttctgaattgctgtcttg ccttggagggggatgtag 311 56,61
14b acagtcccaggctctaca atgattctgcctaaatccaa 231 62,57
15 gcgtgtgtctcacctacttcc ggtcatatacatatcaaacagtaattg 257 60
16 tgagaaagggtgttcagatt tcttcagctacctccagaac 261 5358
17 tggaactaatttcaaatgccc ccaccaaatacttacagggattc 169 54,59
18 ggatgatactccatctcccg tcccagaaaagttaaagtcaaatc 350 57
19 tgtccttaaggcctctgtgc cactccctggacatgtggac 190 60
20 acagttcaccccagtatggc tgtgcataatcactggacaaca 174 59
21 tcctttggttagaacagcag tcaagagaatgaaagggaaa 196 56
22 attgcaagttttcatttggt ttccagagaaagtaacaacg 171 58
23 cggtttatctaagttgtgtaagca ggcttcagataagttttgcca 160 54
24 aacaacagtaaatttgcacctca tttggatccacgaggagag 241 54,59
25 gtggttcccccaccatct cggagctagccactgtgag 205 60
26 tttcctcttcatttctcttca ccagaatgccatgctagttaaa 239 55
27 ttccttaatgttctttctctttg ttccagatctattgtcagca 242 54,59
28 catgcatgttttcacaggat agaagtttcaaaggaaactcaatg 213 57
29 tttcttgtctcctttgtgctt agaaatcttgccgtttttc 236 59
30 gaggccctgtctcaaaaa ctcctccttcccacaacc 350 62
31a gagagtttacgtgcacctcct ccattggttttccgtttg 303 61
31b atcctgccagaagatgaag gttggtgtcgttggagtg 309 62
31c gtggttgggcagcaacag ctgctctctgaatctgcatt 289 63
31d ctcagccaccccttccag ttcaaaggttgaccatgc 337 57,62
31 gccagccatgatgtcagt gcatggtaggtggctgta 320 62
31f gctgttggctgcattcat gatgtctcggaattgtgaag 310 62
31g ctcagcagatgaacatgaac catctgttgctgaaggagtc 314 61
31h aggcaggtgccagtctac agctaccagtccaggatg 305 62
31i ctcagccttctccacacc gctcccaaaatactacaagg 273 61
  1. 1All primer sequences are shown in the 5' to 3' direction. 2The optimal melting temperature for each PCR fragment were calculated using the DHPLC Melt program http://insertion.stanford.edu/melt.html. Where more than one optimal temperature was predicted, both were used in the DHPLC analysis.