Skip to main content

Table 3 Primers for RT-PCR

From: β class II tubulin predominates in normal and tumor breast tissues

β-Tubulin gene Description Sequence (5'→ 3') T m (°C) Amplicon length (base pairs)
Class I Forward CCCCATACATACCTTGAGGCGA 59.8 289
  Reverse GCCAAAAGGACCTGAGCGAA 59.1  
Class II Forward ACGGGTTAGGGAAAGCGGA 59.6 241
  Reverse TTCCGACACAAACGTTTATGTGA 56.7  
Class III Forward ATGCGGGAGATCGTGCACAT 60.6 238
  Reverse CCCCTGAGCGGACACTGT 60.0  
Class IVa Forward TCTCCGCCGCATCTTCCA 59.8 272
  Reverse GCTCTGGGGACATAATTTCCTCCT 60.0  
Class IVb Forward GCTGTTTGTCTACTTCCTCCTGCT 60.4 344
  Reverse CAGTTGTTCCCAGCACCACTCT 60.8  
Class V Forward CGGGGAGGAAGCTTTTGAGGAT 60.5 244
  Reverse CTGGGTAGAACCCGCAATTCTCT 60.2  
Class VI Forward AGTTGTGTTGGGCTCACACCA 60.8 133
  1. T m values were calculated for reaction conditions containing 50 mM NaCl.