Skip to main content

Table 1 Primer compositions for PCRs

From: Expression of glucocorticoid and progesterone nuclear receptor genes in archival breast cancer tissue

Primer name

Sequence (5'–3')

GREX2-F1*

GAGTACCTCTGGAGGACAGA

GREX2-R1

GCTTCTGATCCTGCTGTTGA

GREX2-R2

ATGTCCATTCTTAAGAAACAGGA

PREX4-F1*

ATTGATGACCAGATAACTCTCCAT

PREX4-R1

CTGACGTGTTTGTAGGATCTC

PREX4-R2

GTAGTTAATTTACTGCATAGAGTG

18S-A

CTTAGAGGGACAAGTCGCG

18S-B

GGACATCTAAGGGCATCACA

  1. *Primer labelled with TET at 5'; Primer labelled with HEX at 5'.