Skip to main content

Table 1 Primer compositions for PCRs

From: Expression of glucocorticoid and progesterone nuclear receptor genes in archival breast cancer tissue

Primer name Sequence (5'–3')
GREX2-F1* GAGTACCTCTGGAGGACAGA
GREX2-R1 GCTTCTGATCCTGCTGTTGA
GREX2-R2 ATGTCCATTCTTAAGAAACAGGA
PREX4-F1* ATTGATGACCAGATAACTCTCCAT
PREX4-R1 CTGACGTGTTTGTAGGATCTC
PREX4-R2 GTAGTTAATTTACTGCATAGAGTG
18S-A CTTAGAGGGACAAGTCGCG
18S-B GGACATCTAAGGGCATCACA
  1. *Primer labelled with TET at 5'; Primer labelled with HEX at 5'.