Skip to main content

Table 1 Primer sequences for HER2 chimeric antigen receptor construct

From: Construction and evaluation of a novel humanized HER2-specific chimeric receptor

Gene names Primer names Primer sequences (5′-3′)
CD8a leader AF gcggaattcatggccttaccagtgaccgccttgctcctgccg (EcoRI)
Her2scFv BF tgctccacgccgccaggccgagatctgacattgtgctgacccaaac
BR tgacgagacggtgactgaggttcc
CD8a hinge CF cctcagtcaccgtctcgtcaaccacgacgccagcgccgcg
CR atcacaggcgaagtccagccccc
CD28TM + ICD DF gggggctggacttcgcctgtgatttttgggtgctggtggtggttg
DR ggagcgataggctgcgaagtcgc
CD3ζ EF gcgacttcgcagcctatcgctccagagtgaagttcagcaggagc
  ER gcggtcgacttagcgagggggcagggcctg (SaI1)
  1. Note: EcoR1 and Sal1 restriction enzyme sites are italicized.