Skip to main content

Table 1 List of primers used in this study

From: DACT1, an antagonist to Wnt/β-catenin signaling, suppresses tumor cell growth and is frequently silenced in breast cancer

PCR Primer Sequence (5'-3') Product size (bp) PCR cycles Annealing temperature (°C)
MSP DACT1m3 CGGGATAGTAGTAGTCGGC 118 41 60
  DACT1m4 CGCTAAAACTACGACCGCG    
  DACT1u3 GTTGGGATAGTAGTAGTTGGT 123 41 58
  DACT1u4 AAACACTAAAACTACAACCACA    
RT-PCR DACT1-F AGGAGAAGTTCTTGGAGGAG 179 32 55
  DACT1-R TGAGCTAGGCCGACTGTCTG    
  GAPDH-F GGAGTCAACGGATTTGGT 206 23 55
  GAPDH-R GTGATGGGATTTCCATTGAT    
Real-time PCR DACT1-F GACGAGCAGAGCAATTACACC 158 40 60
  DACT1-R ACCGTTTGAATGGGCAGA    
  β-actin-F CCTGTGGCATCCACGAAACT 314 40 60
  β-actin-R GAAGCATTTGCGGTGGACGAT