Skip to main content

Advertisement

Table 4 Primers used during real-time PCR analysesa

From: Allele-specific regulation of FGFR2 expression is cell type-dependent and may increase breast cancer risk through a paracrine stimulus involving FGF10

Gene and (GeneID)b Sequence ID Primer Primer sequence (5' to 3') Product length Distance from poly(A) tailc Exon-exon boundary
FGF2 NM_002006.4 F ACCTGCAGACTGCTTTTTGCCCA 91 bp 1,731 bp No
(2247)   R GGTGCCACGTGAGAGCAGAGC    
FGF7 NM_002009.3 F CTCAACGGCAAGTTTCCCTCCCTTTTC 80 bp 1,701 bp No
(2252)   R GCCTTCCAGGATTTGCTGGCCC    
FGF10 NM_004465.1 F TCTTCTTCCTCCTCCTTCTCCTCTCC 148 bp 325 bp No
(2255)   R TCCCGCTGACCTTCCCGTTCTTCTC    
FGFR2 d NM_000141.4 F GTCAGTGAGAACAGTAACAACAAG 192 bp 3,368 bp Yes
(2263)   R GTAGCCTCCAATGCGATGC    
GADPH NM_002046.3 F TTCCAGGAGCGAGATCCCT 175 bp 805 bp Yes
(2597)   R CACCCATGACGAACATGGG    
HMBS NM_000190.3 F CTGGTAACGGCAATGCGGCT 338 bp 1010 bp Yes
(3145)   R GCAGATGGCTCCGATGGTGA    
HNRPM NM_005968.3 F GAGGCCATGCTCCTGGG 85 bp 440 bp Yes
(4670)   R TTTAGCATCTTCCATGTGAAATCG    
HPRT1 NM_000194.2 F TGACACTGGCAAAACAATGCA 94 bp 742 bp Yes
(3251)   R GGTCCTTTTCACCAGCAAGCT    
SRPR NM_003139.2 F CATTGCTTTTGCACGTAACCAA 70 bp 1,308 bp Yes
(6734)   R ATTGTCTTGCATGCGGCC    
TBP NM_003194.3 F CACGAACCACGGCACTGATT 89 bp 905 bp Yes
(6908)   R TTTTCTTGCTGCCAGTCTGGAC    
  1. aFGF: fibroblast growth factor gene; FGFR: fibroblast growth factor receptor gene; GAPDH: glyceraldehyde 3-phosphate dehydrogenase gene; HMBS: hydroxymethylbilane synthase gene; HNRPM: heterogeneous nuclear ribonucleoprotein M gene; HPRT1: hypoxanthine phosphoribosyltransferase 1 gene; SRPR: signal recognition particle receptor gene; TBP: TATA box binding protein gene; F: forward primer; R: reverse primer; bp: base pair. For each gene, the forward and reverse primer sequences, the length of the resulting PCR product (using cDNA as template) and the distance from the poly(A) tail are shown, as is the information about whether the PCR product includes an exon-exon boundary. bGeneID from EntrezGene accessed 2 June 2010. cDistance from 3' end of the PCR product to 5' beginning of the poly(A) tail. dPrimer set for FGFR2 is in a region of FGFR2 that is present in both FGFR2 IIIb and FGFR2 IIIc.