Skip to main content

Advertisement

Table 3 Primers used to genotype four SNPs in FGFR2a

From: Allele-specific regulation of FGFR2 expression is cell type-dependent and may increase breast cancer risk through a paracrine stimulus involving FGF10

SNP Primer Primer sequence (5' to 3') Product length Annealing temperature Further analysis
rs10736303 F AGGGACAAATACTCCGCACA 405 bp 50°C Sanger sequencing
  R AGCCATCCAGCATGTTTCTC    
rs2981578 F TGACTCTTCAAAGTTTGTTTGTTTT 295 bp 50°C Restriction enzyme AciI (New England Biolabs, Ipswich, MA, USA)
  R GAGGAAAGGTTCCCCACACT    
rs2981582 F AGCTCAGCTTACCCCAGACA 215 bp 58°C Restriction enzyme AciI (New England Biolabs, Ipswich, MA, USA)
  R CGTGAGCCAAGCCTCTACTT    
rs7895676 F CAGGTGCGGTGGCTCATGTC 345 bp 67°C Sanger sequencing
  R GACTTCAATGGCGGGACTCC    
  1. aFGFR2: fibroblast growth factor receptor 2 gene; F: forward primer; R: reverse primer; bp: base pair. For each SNP, the forward and reverse primer sequences, the length of the resulting PCR product and the annealing temperature used during PCR are shown. Also shown is the technique that was used on the resulting PCR fragment to genotype the SNPs.