Skip to main content

Table 1 Primer and siRNA sequences used in this study

From: Chondroitin sulfates play a major role in breast cancer metastasis: a role for CSPG4 and CHST11gene expression in forming surface P-selectin ligands in aggressive breast cancer cells

Primer Sequence
18S forward
18S reverse
5' TTCGAACGTCTGCCCTATCAA 3'
5' ATGGTAGGCACGGCGACTA 3'
β-actin forward
β-actin reverse
5' GACTTCGAGCAAGAGATGGCCAC3'
5' CAATGCCAGGGTACATGGTGGTG3'
CHST3 forward
CHST3 reverse
5' GACTTTGTGCACAGCCTGAA 3'
5' AGAGCTTGGGGAATCTGCTT 3'
CHST7 forward
CHST7 reverse
5' GGGGCAATCTGTCACACTCT 3'
5' AATTGCACAGCAGTTGTTGG 3'
CHST11 forward
CHST11 reverse
5' TCCCTTTGGTGTGGACATCT 3'
5' CACGTGTCTGTCACCTGGTC 3'
CHST12 forward
CHST12 reverse
5' GCACACGTCCTTCTCTAGGC 3'
5' AAACTCGTCGACATCGGAGT 3'
CHST13 forward
CHST13 reverse
5' CCGGCATTTGGAAACAGAG 3'
5' GGGTCCTGATCCAGGTCATA 3'
CHST14 forward
CHST14 reverse
5' TCTGATCCCCCATTTATCCA 3'
5' GGAGCAGAAAGGCACAAAAG3'
CHST15 forward
CHST15 reverse
5' TGAGTTCACGACCAGACAGC 3'
5' CGTACCAACAGGGGCTCTTA 3'
CSPG4 forward
CSPG4 reverse
5' CACACAGAGGAACCCTCGAT 3'
5' CTTCAGCGAGAGGAGCACTT 3'
ER1 forward
ER1 reverse
5' AGGTGGGATACGAAAAGACCG 3'
5' AAGGTTGGCAGCTCTCATGTC 3'
GAPDH forward
GAPDH reverse
5' ACAGTCAGCCGCATCTTCTT 3'
5' ACGACCAAATCCGTTGACTC 3'
NRP-1 forward
NRP-1 reverse
5' CAAGGTGTTCATGAGGAAGTTCAA 3'
5' CCGCAGCTCAGGTGTATCATAGT 3'
SDC-1 forward
SDC-1 reverse
5' GCTCTGGGGATGACTCTGAC 3'
5' GGTCTGCTGTGACAAGGTGA3'
SDC-4 forward
SDC-4 reverse
5' GTCTGGCTCTGGAGATCTGG3'
5' CACCAAGGGATGGACAACTT3'
siRNA Sequence
#31
#32
#33
UCAGUAGUUCUCGUAGACUtt
UUCUGGGUGAACUUGUUGCgg
AUCGAGUUUGUAGACUUCGta
  1. 18S, 18S ribosomal RNA; CHST3, Carbohydrate (chondroitin 6) sulfotransferase 3; CHST7, Carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7; CHST11, Carbohydrate (Chondroitin 4) Sulfotransferase 11; CHST12, Carbohydrate (Chondroitin 4) Sulfotransferase 12; CHST13, Carbohydrate (Chondroitin 4) Sulfotransferase 13; CHST14, Carbohydrate (N-acetylgalactosamine 4-O) Sulfotransferase 14; CHST15, Carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) Sulfotransferase 15; CSPG4, Chondroitin Sulfate Proteoglycan 4; ER1, Estrogen Receptor 1; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; NPR-1, Neuropilin-1; SDC-1, Syndecan-1; SDC-4, Syndecan-4; siRNA, short interfering RNA.