Skip to main content

Table 2 Primer sequences

From: Mutations in the epidermal growth factor receptor (EGFR) gene in triple negative breast cancer: possible implications for targeted therapy

Exon Forward Primer Reverse Primer PCR product size (bp)
Exon 18 CTGAGGTGACCCTTGTCTCTGTGTTCTT AGAGGCCTGTGCCAGGGACCTTA 186
Exon 19 [24] TCACTGGGCAGCATGTGGCA CAGCTGCCAGACATGAGAAA 241
Exon 20 CCATGCGAAGCCACACTGA CGTATCTCCCTTCCCTGATTACC 248
Exon 21 AGCAGGGTCTTCTCTGTTTCA TGACCTAAAGCCACCTCCTT 200
  1. bp, base pairs; PCR, polymerase chain reaction.