Skip to main content

Table 1 Primer sequences for RT-PCR and asymmetric PCR

From: Association of invasion-promoting tenascin-C additional domains with breast cancers in young women

Primer Sequence 5' to 3'
T8 - forward CAATCCAGCGACCATCAACG
T18 - reverse CGTCCACAGTTACCATGGAG
T16 - reverse GTTGTCAACTTCCGGTTCGG
AD1 - forward TGGTGGAGAACACTGGCTATGAC
AD1 - reverse GGGATCCCCAGCCAAGGT
AD1-FAM-MGB CAGTGTGGCAGGAAC
AD2 - forward GATCACCCCCATGAGACCAT
AD2 - reverse TGATGACAGAGCTGC GAGACA
AD2-FAM-MGB TGCTGTCTGTGCCTGG
GAPDH - forward AGAACATCATCCCTGCCTC
GAPDH - reverse GCCAAATTCGTTGTCATACC
Actin antisense TCATCACCATTGGCAATGAG
Actin sense CTAGAAGCATTTGCGGTGGA
AD1 antisense GAACCAAAGCCACAGTTGG
AD1 sense TAATGACAAAGGCAGTGAG
  1. Sense and antisense primers were used to generate single-stranded DNA probes for in situ hybridisation.