Skip to main content

Table 3 Oligonucleotide primers used in this study

From: Frequent loss of endothelin-3 (EDN3) expression due to epigenetic inactivation in human breast cancer

  Sequence (5'↔3') TA, °C Cycles Product, base pairs
RT-PCR     
   GAPDH     
  Forward: TGGTCACCAGGGCTGCTT 60 35 510
  Reverse: GTCTTCTGGGTGGCAGTGAT    
Real-time PCR     
   GAPDH     
  Forward: GAAGGTGAAGGTCGGAGTCA 58 40 108
  Reverse: TGGACTCCACGACGTACTCA    
   EDN1     
  Forward: GCTCGTCCCTGATGGATAAA 58 40 216
  Reverse: TTCCTGCTTGGCAAAAATTC    
   EDN2     
  Forward: TTGGACATCATCTGGGTGAA 58 40 229
  Reverse: CTGTAGTGGCCCCTGTCTTG    
   EDN3     
  Forward: ATTGCCACCTGGACATCATT 58 40 179
  Reverse: GCAGGCCTTGTCATATCTCC    
Methylation-specific PCR     
   EDN3-U     
  Forward: TTTGGGAGGTGATTTTTAGTGTGTTT 60 35 144
  Reverse: ACCCATCCCTACACAAAACTAACCA    
   EDN3-M     
  Forward: TGGGAGGCGATTTTTAGTGCGTTC 60 35 140
  Reverse: CCATCCCTACGCGAAACTAACCG    
  1. EDN, endothelin; EDN3-M, endothelin-3 methylated; EDN3-U, endothelin-3 unmethylated; GAPDH, glyceraldehyde-3-phosphate-dehydrogenase; PCR, polymerase chain reaction; RT-PCR, reverse transcription-polymerase chain reaction; TA, annealing temperature.