Skip to main content

Table 2 List of the oligonucleotides sequences used for quantitative real-time PCR

From: Evidence that molecular changes in cells occur before morphological alterations during the progression of breast ductal carcinoma

  Gene symbol Annotation Primer sequences
Target genes CGI-41 CGI-41 protein Forward: CCAGGCGTGCAGGGTATC
Reverse: GCCCCCGCTGCACAT
  C16orf5 Chromosome 16 open reading frame 5 Forward: CAGCCAGAGCAGTTAGCCAGTTA
Reverse: CTGACTCCAGACAACTTACCCATTC
  GOSR2 Golgi SNAP receptor complex member 2 Forward:GCAGGAGAGACAGCGAGAAGA
Reverse:TGCAGTGATTCGTCCATTGG
  MARK3 MAP/microtubule affinity-regulating kinase 3 Forward: AGACACTCAGTGATTCAGAATGGC
Reverse: GAAGCAACTGGAGTTCTCTGATCA
  LOX Lysyl oxidase Forward: CAGGACATCATGCGTATGCC
Reverse: CCAGGCACTGATTTATCCATTG
  STK25 Serine/threonine kinase 25 (STE20 homolog, yeast) Forward: ACCTGGTGGAGCGAGTGC
Reverse: TTCAGCGGGTGGATGTCAG
  SULF-1 Sulfatase 1 Forward:GGCATTTTGAATCAGCTACACGTA
Reverse:TCCCATCCATCCCATAACTGTC
  TXNL2 Thioredoxin-like 2 Forward: GACCACAGGCGTGCACC
Reverse: GATACCTTTCCTCATCCATCACAAG
Endogenous genes HPRT hypoxanthine phosphoribosyltransferase 1 Forward: GAACGTCTTGCTCGAGATGTGA
Reverse: TCCAGCAGGTCAGCAAAGAAT
  GAPDH Glyceraldehyde 3-phosphate dehydrogenase Forward: ACCCACTCCTCCACCTTTGA
Reverse: CTGTTGCTGTAGCCAAATTCGT
  BCR Breakpoint cluster region Forward: CCTTCGACGTCAATAACAAGGAT
Reverse: CCTGCGATGGCGTTCAC