Skip to main content

Advertisement

Table 1 The oligonucleotide sequences of shRNA (short hairpin RNA) driven by CMV(Cytomegalovirus) promoter in pcDNA™6.2-GW/EmGFP-miR (peroxiredoxin 6; GenBank accession no. D14662) (Invitrogen, San Diego, CA, USA)

From: Identification of the functional role of peroxiredoxin 6 in the progression of breast cancer

  Top oligo Bottom oligo
pCMV-PRDX6miRNA-122 (122–142 nt) TGCTGCCATGAGTCTCCCAGAAAGTC GTTTTGGCCACTGACTGACGACTTTCTGAGACTCATGG CCTGCCATGAGTCTCAGAAAGTCGTCAGTCAGTGGCCAAAAC GACTTTCTGGGAGACTCATGGC
pCMV-PRDX6miRNA-251 (251–271 nt) TGCTGAACACTGTCTATTGAAAGGGC GTTTTGGCCACTGACTGACGCCCTTTCTAGACAGTGTT CCTGAACACTGTCTAGAAAGGGCGTCAGTCAGTGGCCAAAAC GCCCTTTCAATAGACAGTGTTC
pCMV-PRDX6miRNA-289 (289–309 nt) TGCTGTAAGCATTGATATCCTTGCTC GTTTTGGCCACTGACTGACGAGCAAGGATCAATGCTTA CCTGTAAGCATTGATCCTTGCTCGTCAGTCAGTGGCCAAAAC GAGCAAGGATATCAATGCTTAC
pCMV-PRDX6miRNA-672 (672–692 nt) TGCTGATTTCTTGCCAGATGGGAGCT GTTTTGGCCACTGACTGACAGCTCCCATGGCAAGAAAT CCTGATTTCTTGCCATGGGAGCTGTCAGTCAGTGGCCAAAAC AGCTCCCATCTGGCAAGAAATC