Skip to main content

Table 1 RAD51 PCR conditions

From: Variation in the RAD51 gene and familial breast cancer

Exon PCR fragment Forward primer Reverse primer Annealing temperature (°C)a Size (bp) DHPLC temperature (°C)
1 1 GCAAGCGAGTAGAGAAGTGGA AACTGCCGCTGAGCACTG 54 218 65
2 2 ATGGCCTTGGCTTTTCCTAA GGCCCTGCCAGACATATTTA 54 391 57
3 3 TGGAACCAACTTCCCATCTC TTCCCACTAATGCCTCCCTA 54 341 58
4 4 CTCTTCCCATTGCACACCTT CACCTGGCCTTCCTCTATCTC 54 371 52, 57
5 5 TCTGATGAGCTCCAAGAACA TGACATGGAAGGATTTTGAAG 51 344 58
6 6 AAGGGAATGCCTCCTTCCTA CCAAACTAACCCTGGCAATC 54 314 59
7 7 CAAATTGCTCATCTGCCTG TGAGGCACCGTTTAACAAGA 54 397 59
8 8 TGGTAAGGAAGGGACCAGAA TGTGGCCATAGACACTCCAA 57 390 60
9 9 TCGTTATTTTGTGGGGGAAA ACAGGGGAGAGGCATATCAA 54 447 58
10 10a TTGGTGCTTTGGTCTGTGTC ATACCCCTCCTCCAAAACCA 54 409 59
10 10b CAGGAGACAGGTCAGTAGTCACA AGGTTTGGCACAAGACTCCA 51 374 57
10 10c TGATCTTGTGTAAGGGTTTGGTT GCAATCTCGACTCACTGCAA 51 375 60
10 10d GATAGCCTGAGGTGGGAGAA TCTGCAAGTGGGACTTTCCT 54 319 60
  1. a'Touchdown' PCR amplification conditions were as follows: denaturation at 94°C for 10 minutes, followed by two cycles of 94°C for 30 seconds, 30 seconds at the fragment annealing temperature (TA) + 6°, and 72°C for 30 seconds. The conditions remained the same for the rest of the PCR except for the annealing temperature, which consisted of two cycles at (TA + 4°C), then two cycles at (TA + 2°C) and, finally, 35 cycles at the TA. A final extension step was conducted at 72°C for 7 minutes.